telomere.dev

$ telomere --init

  _       _                                   _
 | |_ ___| | ___  _ __ ___   ___ _ __ ___  __| | _____   __
 | __/ _ \ |/ _ \| '_ ` _ \ / _ \ '__/ _ \/ _` |/ _ \ \ / /
 | ||  __/ | (_) | | | | | |  __/ | |  __/ (_| |  __/\ V /
  \__\___|_|\___/|_| |_| |_|\___|_|  \___|\__,_|\___| \_/
                

$ telomere endpoints --list

GET /api/v1/sequence/:id

GET /api/v1/length/:sample

POST /api/v1/analyze

GET /api/v1/compare/:a/:b

GET /api/v1/fish/:image

$

Getting Started

Install the SDK and start querying telomere sequence data in minutes.

install

$ npm install @telomere/sdk

+ @telomere/sdk@2.4.0

added 12 packages in 3.2s

example.js

import { Telomere } from '@telomere/sdk';

const client = new Telomere({ apiKey: process.env.TELOMERE_KEY });

const result = await client.analyze({

sample: 'TTAGGGTTAGGGTTAGGG',

method: 'qPCR'

});

result.length; // 8.4 kb

api-reference

// Analyze telomere length from a DNA sample

POST /api/v1/analyze

// Request body

{

"sample": "TTAGGGTTAGGGTTAGGG...",

"method": "qPCR" | "TRF" | "FISH",

"reference": "hg38"

}

// Response

{

"length_kb": 8.4,

"repeats": 1400,

"percentile": 62,

"status": "normal"

}

API Playground

Test the telomere API live. Type a command or click an example below.

playground
$

Telomere Sequence

Human telomeric DNA consists of TTAGGG tandem repeats at chromosome ends, protecting chromosomes from degradation.

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
T - Thymine A - Adenine G - Guanine

Changelog

git log --oneline

a3f8c21 2026-03-10

feat: add batch analysis endpoint for multi-sample processing

9e2d1b4 2026-02-28

fix: correct qPCR length estimation for short telomeres

7c4a0f9 2026-02-15

feat: add FISH image analysis support via /api/v1/fish

1b8e3d2 2026-01-30

chore: upgrade to Node 22, update all dependencies

e5c9a07 2026-01-12

feat: add telomere repeat finder for custom organisms

b2d4f18 2025-12-20

BREAKING: v2 API — rename /measure to /analyze